<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2156-7-22</ui>
   <ji>1471-2156</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Discovery, linkage disequilibrium and association analyses of polymorphisms of the immune complement inhibitor, decay-accelerating factor gene (DAF/CD55) in type 1 diabetes</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Taniguchi</snm>
               <fnm>Hidenori</fnm>
               <insr iid="I1"/>
               <email>htaniguc@geriat.med.osaka.u.ac.jp</email>
            </au>
            <au id="A2">
               <snm>Lowe</snm>
               <mi>E</mi>
               <fnm>Christopher</fnm>
               <insr iid="I1"/>
               <email>chris.lowe@cimr.cam.ac.uk</email>
            </au>
            <au id="A3">
               <snm>Cooper</snm>
               <mi>D</mi>
               <fnm>Jason</fnm>
               <insr iid="I1"/>
               <email>jason.cooper@cimr.cam.ac.uk</email>
            </au>
            <au id="A4">
               <snm>Smyth</snm>
               <mi>J</mi>
               <fnm>Deborah</fnm>
               <insr iid="I1"/>
               <email>debbie.smyth@cimr.cam.ac.uk</email>
            </au>
            <au id="A5">
               <snm>Bailey</snm>
               <fnm>Rebecca</fnm>
               <insr iid="I1"/>
               <email>rebecca.bailey@cimr.cam.ac.uk</email>
            </au>
            <au id="A6">
               <snm>Nutland</snm>
               <fnm>Sarah</fnm>
               <insr iid="I1"/>
               <email>sarah.nutland@cimr.cam.ac.uk</email>
            </au>
            <au id="A7">
               <snm>Healy</snm>
               <mi>C</mi>
               <fnm>Barry</fnm>
               <insr iid="I1"/>
               <email>barry.healy@cimr.cam.ac.uk</email>
            </au>
            <au id="A8">
               <snm>Lam</snm>
               <mi>C</mi>
               <fnm>Alex</fnm>
               <insr iid="I1"/>
               <email>alex.lam@bbsrc.ac.uk</email>
            </au>
            <au id="A9">
               <snm>Burren</snm>
               <fnm>Oliver</fnm>
               <insr iid="I1"/>
               <email>oliver.burren@cimr.cam.ac.uk</email>
            </au>
            <au id="A10">
               <snm>Walker</snm>
               <mi>M</mi>
               <fnm>Neil</fnm>
               <insr iid="I1"/>
               <email>neil.walker@cimr.cam.ac.uk</email>
            </au>
            <au id="A11">
               <snm>Smink</snm>
               <mi>J</mi>
               <fnm>Luc</fnm>
               <insr iid="I1"/>
               <email>luc.smink@cimr.cam.ac.uk</email>
            </au>
            <au id="A12">
               <snm>Wicker</snm>
               <mi>S</mi>
               <fnm>Linda</fnm>
               <insr iid="I1"/>
               <email>linda.wicker@cimr.cam.ac.uk</email>
            </au>
            <au id="A13" ca="yes">
               <snm>Todd</snm>
               <mi>A</mi>
               <fnm>John</fnm>
               <insr iid="I1"/>
               <email>john.todd@cimr.cam.ac.uk</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Juvenile Diabetes Research Foundation/Wellcome Trust Diabetes and Inflammation Laboratory, Cambridge Institute for Medical Research, University of Cambridge, Hills Road, Cambridge, CB2 2XY, UK</p>
            </ins>
         </insg>
         <source>BMC Genetics</source>
         <issn>1471-2156</issn>
         <pubdate>2006</pubdate>
         <volume>7</volume>
         <issue>1</issue>
         <fpage>22</fpage>
         <url>http://www.biomedcentral.com/1471-2156/7/22</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16626483</pubid>
               <pubid idtype="doi">10.1186/1471-2156-7-22</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>22</day>
               <month>2</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>20</day>
               <month>4</month>
               <year>2006</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>20</day>
               <month>4</month>
               <year>2006</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2006</year>
         <collab>Taniguchi et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Type 1 diabetes (T1D) is a common autoimmune disease resulting from T-cell mediated destruction of pancreatic beta cells. Decay accelerating factor (DAF, CD55), a glycosylphosphatidylinositol-anchored membrane protein, is a candidate for autoimmune disease susceptibility based on its role in restricting complement activation and evidence that DAF expression modulates the phenotype of mice models for autoimmune disease. In this study, we adopt a linkage disequilibrium (LD) mapping approach to test for an association between the DAF gene and T1D.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Initially, we used HapMap II genotype data to examine LD across the <it>DAF</it> region. Additional resequencing was required, identifying 16 novel polymorphisms. Combining both datasets, a LD mapping approach was adopted to test for association with T1D. Seven tag SNPs were selected and genotyped in case-control (3,523 cases and 3,817 controls) and family (725 families) collections.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>We obtained no evidence of association between T1D and the <it>DAF </it>region in two independent collections. In addition, we assessed the impact of using only HapMap II genotypes for the selection of tag SNPs and, based on this study, found that HapMap II genotypes may require additional SNP discovery for comprehensive LD mapping of some genes in common disease.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>T1D is characterised as a common autoimmune disease, mainly resulting from a T-cell mediated destruction of pancreatic beta cells that leaves patients completely dependent on exogenous insulin to regulate their blood glucose level. T1D is strongly clustered in families with an overall genetic risk ratio, an estimate of the familial clustering of the disease, of approximately 15<abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. However, of the hundreds of association studies reported to date, only four loci have been identified and successfully replicated: the HLA class II genes on chromosome 6p21<abbrgrp><abbr bid="B2">2</abbr></abbrgrp>; the insulin gene (<it>INS</it>) on chromosome 11p15<abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>; <it>CTLA4 </it>on chromosome 2q33<abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>; and <it>PTPN22 </it>on chromosome 1p13<abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>. <it>CD25 </it>on chromosome 10p15 has been implicated, but this finding awaits independent replication<abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Given that these genes alone cannot explain the familial clustering of T1D, many other genes remain to be identified.</p>
         <p>Recently, there have been several reports focusing on the relationship between autoimmune disease and the complement system, which is composed of more than 30 soluble and membrane-bound proteins<abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp> and plays an important role in innate host defence. As inappropriate regulation of the complement system can lead to significant damage of host tissues<abbrgrp><abbr bid="B12">12</abbr></abbrgrp>, a number of membrane-bound complement regulatory proteins are active, such as DAF, a glycosylphosphatidylinositol-anchored membrane protein that restricts complement activation by inhibiting the formation of C3 convertases in both the classical and alternative pathways<abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>.</p>
         <p>Dysfunction of human DAF on erythrocytes contributes to the paroxysmal nocturnal hemoglobinuria (PNH) by increasing their sensitivity to complement lysis<abbrgrp><abbr bid="B13">13</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>. In addition, a proportion of DAF-deficient (Cromer INAB) patients develop inflammatory bowel disease. However, little is known about DAFs role in autoimmune disease <it>in vivo</it><abbrgrp><abbr bid="B17">17</abbr></abbrgrp>.</p>
         <p>Recently, it has been reported that DAF modulates T cell immunity by controlling T cell- and antigen-presenting cell- induced alternative pathway of C3 activation during cognate interactions <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. According to gene targeting studies, mice deficient in the DAF1 gene, the murine homologue of human <it>DAF</it>, showed more susceptibility to complement mediated inflammatory injury, especially DAF1 deficient female mice in a MRL/lpr background, a model for human systemic lupus erythematosus, which showed aggravated lymphadenopathy and splenomegaly, higher serum anti-chromatin autoantibody levels, and dermatitis<abbrgrp><abbr bid="B21">21</abbr></abbrgrp>.</p>
         <p>Given this prior evidence, DAF may function as a negative regulator of autoimmune response by modulating T cell activity and directly protecting host tissues <it>in vivo </it>and that recombinant DAF may be an ideal therapeutic agent for autoimmunity<abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. On the other hand, <it>DAF </it>does not lie under any of the reported T1D linkage peaks<abbrgrp><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp> nor have there been any reports of genetic association studies between <it>DAF </it>and autoimmune disease, although recently differential expression of DAF was observed when comparing T cells from nonobese diabetic (NOD) mice and diabetes-resistant NOD mice having a congenic interval containing the DAF gene thereby making it a candidate gene for the <it>Idd5.4 </it>region (William Ridgway and Linda Wicker, unpublished observations).</p>
         <p>In this study, to elucidate the susceptibility of <it>DAF </it>with T1D, we performed an association study using a LD mapping approach, together with the direct analysis of three non-synonymous SNPs (nsSNPs) in large case-control and family collections.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Linkage disequilibrium analysis</p>
            </st>
            <p>Initially, we used phase II genotyping data from the HapMap project<abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>, a catalogue of common human genetic variants, providing their allele frequencies and intermarker LD patterns among people, within and among populations from African, Asian, and European ancestry. In the <it>DAF </it>region, about 40 kb on chromosome 1q32, 21 common SNPs (minor allele frequency (MAF) &#8805; 0.05), have been genotyped in 60 U.S.A. residents with northern and western European ancestry, collected in 1980 by the Centre d'Etude du Polymorphisme Humain (CEPH, CEU). We note that all of these SNPs were located in non-coding regions and that the average inter-SNP distance was 2 kb. A LD map of the region, using pairwise D', shows little evidence of recombination within the region (Figure <figr fid="F1">1a</figr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>LD map for human <it>DAF </it>region on Chromosome 1q32</p>
               </caption>
               <text>
                  <p><b>LD map for human <it>DAF </it>region on Chromosome 1q32</b>. All markers with the MAF of less than 0.05 or with insufficient genotyping data were excluded in the LD measurement. <b>a. </b>LD map with 21 markers genotyped in 60 individuals obtained from HapMap II. <b>b. </b>LD map with 22 markers identified by resequencing with 32 CEPH's individuals. figure c. LD map with 38 markers, a combined dataset of both HapMap II and in-house resequencing data with 32 CEPH's individuals.</p>
               </text>
               <graphic file="1471-2156-7-22-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p><it>DAF </it>resequencing</p>
            </st>
            <p>As we were concerned about adopting a LD mapping approach given the HapMap SNP density<abbrgrp><abbr bid="B27">27</abbr></abbrgrp>, we resequenced <it>DAF </it>in 32 CEPH individuals, selected from the 60 CEPH individuals used by the HapMap project, to increase the SNP density across the region.</p>
            <p>Analysis of the resequencing data identified 32 polymorphisms, 26 of which were SNPs and six were deletion/insertion polymorphisms (DIPs), of which 12 SNPs and four DIPs were novel when compared to dbSNP build 125 (Table <tblr tid="T1">1</tblr>). Twenty-two polymorphisms were common (MAF &#8805; 0.05), five of which were also found in the HapMap II data. The relatively small number of common polymorphisms found in both datasets is not unexpected, as HapMap II SNPs were selected to provide an even coverage in terms of distance across the genome, whereas the resequencing is focused on regions of interest and extracts all common polymorphisms present in these individuals. A LD map of the region, based on these 22 polymorphisms (Figure <figr fid="F1">1b</figr>), revealed additional evidence of recombination within the region over and above that apparent in HapMap II data alone (Figure <figr fid="F1">1a</figr>). There was a breakdown in LD towards the 5' end of <it>DAF </it>that was not evident in HapMap II data.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Polymorphisms identified in human <it>DAF</it>. Map positions on human chromosome 1 were from NCBI build 35. Selected tag SNPs are in boldface. Alleles are coded Major > Minor. MAF calculated from the 32 individuals used for tag SNP selection, except for nsSNPs, in which case the MAF is calculated from genotyped controls. DIL = identified by in-house resequencing, HapMap = identified in HapMap II dataset, DIL&amp;HapMap II = Identified in both in-house resequencing and HapMap II dataset.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Polymorphism &#8211; dbSNP(build125)</b>
                        </p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>
                           <b>Location</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>MAF</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Allelic </b>
                           <b>
                              <it>R</it>
                           </b>
                           <sup>2</sup>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Dataset</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Position(NCBI35)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Gene</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853051(G > C)</p>
                     </c>
                     <c ca="center">
                        <p>203881344</p>
                     </c>
                     <c ca="center">
                        <p>promoter</p>
                     </c>
                     <c ca="center">
                        <p>0.03</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853052(C > T)</p>
                     </c>
                     <c ca="center">
                        <p>203881734</p>
                     </c>
                     <c ca="center">
                        <p>promoter</p>
                     </c>
                     <c ca="center">
                        <p>0.03</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs6685886(C > A)</p>
                     </c>
                     <c ca="center">
                        <p>203882613</p>
                     </c>
                     <c ca="center">
                        <p>promoter</p>
                     </c>
                     <c ca="center">
                        <p>0.46</p>
                     </c>
                     <c ca="center">
                        <p>85.07</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>rs2564978(C > T)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>203882811</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>promoter</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.33</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>tag SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DIL &amp; HapMap</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs3841376 (TAGTTACTTCCCCTCCTTCCC > -)</p>
                     </c>
                     <c ca="center">
                        <p>203882879</p>
                     </c>
                     <c ca="center">
                        <p>promoter</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>100.00</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>ss49853053(A > G)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>203883074</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>promoter</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.26</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>tag SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DIL</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853054(T > C)</p>
                     </c>
                     <c ca="center">
                        <p>203883723</p>
                     </c>
                     <c ca="center">
                        <p>intron 1</p>
                     </c>
                     <c ca="center">
                        <p>0.02</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs7533852(G > T)</p>
                     </c>
                     <c ca="center">
                        <p>203883822</p>
                     </c>
                     <c ca="center">
                        <p>intron 1</p>
                     </c>
                     <c ca="center">
                        <p>0.44</p>
                     </c>
                     <c ca="center">
                        <p>89.15</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853055(TA > -)</p>
                     </c>
                     <c ca="center">
                        <p>203884424</p>
                     </c>
                     <c ca="center">
                        <p>intron 2</p>
                     </c>
                     <c ca="center">
                        <p>0.03</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>rs4844590(C > T)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>203884524</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>intron 2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.23</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>tag SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DIL</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs2782828(G > T)</p>
                     </c>
                     <c ca="center">
                        <p>203885394</p>
                     </c>
                     <c ca="center">
                        <p>intron 2</p>
                     </c>
                     <c ca="center">
                        <p>0.24</p>
                     </c>
                     <c ca="center">
                        <p>94.47</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853056(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>203886206</p>
                     </c>
                     <c ca="center">
                        <p>intron 2</p>
                     </c>
                     <c ca="center">
                        <p>0.03</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>ss49853057(C > G)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>203887670</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>intron 4</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.13</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>tag SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DIL</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853058(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>203888427</p>
                     </c>
                     <c ca="center">
                        <p>intron 4</p>
                     </c>
                     <c ca="center">
                        <p>0.03</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs4844591(T > C)</p>
                     </c>
                     <c ca="center">
                        <p>203888688</p>
                     </c>
                     <c ca="center">
                        <p>intron 5</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>90.27</p>
                     </c>
                     <c ca="center">
                        <p>DIL &amp; HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs4844592(A > T)</p>
                     </c>
                     <c ca="center">
                        <p>203889606</p>
                     </c>
                     <c ca="center">
                        <p>intron 5</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>90.27</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs6703002(G > T)</p>
                     </c>
                     <c ca="center">
                        <p>203890767</p>
                     </c>
                     <c ca="center">
                        <p>intron 5</p>
                     </c>
                     <c ca="center">
                        <p>0.32</p>
                     </c>
                     <c ca="center">
                        <p>88.10</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs6700168(C > A)</p>
                     </c>
                     <c ca="center">
                        <p>203890929</p>
                     </c>
                     <c ca="center">
                        <p>intron 5</p>
                     </c>
                     <c ca="center">
                        <p>0.38</p>
                     </c>
                     <c ca="center">
                        <p>82.68</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs925130(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>203891827</p>
                     </c>
                     <c ca="center">
                        <p>intron 5</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>100.00</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs925131(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>203892116</p>
                     </c>
                     <c ca="center">
                        <p>intron 5</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>90.27</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853059(C > T)</p>
                     </c>
                     <c ca="center">
                        <p>203892582</p>
                     </c>
                     <c ca="center">
                        <p>intron 5</p>
                     </c>
                     <c ca="center">
                        <p>0.02</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>rs2184476(A > G)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>203893064</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>intron 6</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.45</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>tag SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DIL</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>rs1507757(A > C)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>203893143</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>intron 6</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.35</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>tag SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DIL</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs6662070(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>203894104</p>
                     </c>
                     <c ca="center">
                        <p>intron 6</p>
                     </c>
                     <c ca="center">
                        <p>0.31</p>
                     </c>
                     <c ca="center">
                        <p>100.00</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs1507758(C > G)</p>
                     </c>
                     <c ca="center">
                        <p>203895876</p>
                     </c>
                     <c ca="center">
                        <p>intron 6</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>90.27</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs1507759(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>203896023</p>
                     </c>
                     <c ca="center">
                        <p>intron 6</p>
                     </c>
                     <c ca="center">
                        <p>0.32</p>
                     </c>
                     <c ca="center">
                        <p>100.00</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs12075906(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>203896494</p>
                     </c>
                     <c ca="center">
                        <p>intron 6</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>100.00</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs1354942(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>203896887</p>
                     </c>
                     <c ca="center">
                        <p>intron 6</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>90.27</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs7555030(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>203897125</p>
                     </c>
                     <c ca="center">
                        <p>intron 6</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>100.00</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs7544288(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>203897417</p>
                     </c>
                     <c ca="center">
                        <p>intron 6</p>
                     </c>
                     <c ca="center">
                        <p>0.41</p>
                     </c>
                     <c ca="center">
                        <p>97.09</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs1507760(T > C)</p>
                     </c>
                     <c ca="center">
                        <p>203897760</p>
                     </c>
                     <c ca="center">
                        <p>intron 6</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>100.00</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs1507761(C > T)</p>
                     </c>
                     <c ca="center">
                        <p>203898194</p>
                     </c>
                     <c ca="center">
                        <p>intron 6</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>100.00</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853060(C > T)</p>
                     </c>
                     <c ca="center">
                        <p>203898910</p>
                     </c>
                     <c ca="center">
                        <p>intron 7</p>
                     </c>
                     <c ca="center">
                        <p>0.04</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs10746462(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>203898943</p>
                     </c>
                     <c ca="center">
                        <p>intron 7</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>90.27</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs10746463(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>203898991</p>
                     </c>
                     <c ca="center">
                        <p>intron 7</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>90.27</p>
                     </c>
                     <c ca="center">
                        <p>DIL &amp; HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853061(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>203899255</p>
                     </c>
                     <c ca="center">
                        <p>intron 8</p>
                     </c>
                     <c ca="center">
                        <p>0.02</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs2135923(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>203914988</p>
                     </c>
                     <c ca="center">
                        <p>intron 10</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>90.27</p>
                     </c>
                     <c ca="center">
                        <p>HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853066(- > TT)</p>
                     </c>
                     <c ca="center">
                        <p>203921271</p>
                     </c>
                     <c ca="center">
                        <p>intron 10</p>
                     </c>
                     <c ca="center">
                        <p>0.39</p>
                     </c>
                     <c ca="center">
                        <p>97.09</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853062(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>203922987</p>
                     </c>
                     <c ca="center">
                        <p>3'</p>
                     </c>
                     <c ca="center">
                        <p>0.02</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs11120766(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>203923074</p>
                     </c>
                     <c ca="center">
                        <p>3'</p>
                     </c>
                     <c ca="center">
                        <p>0.45</p>
                     </c>
                     <c ca="center">
                        <p>84.94</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs1507765(A > C)</p>
                     </c>
                     <c ca="center">
                        <p>203923641</p>
                     </c>
                     <c ca="center">
                        <p>3'</p>
                     </c>
                     <c ca="center">
                        <p>0.45</p>
                     </c>
                     <c ca="center">
                        <p>84.94</p>
                     </c>
                     <c ca="center">
                        <p>DIL &amp; HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs11307618(A > -)</p>
                     </c>
                     <c ca="center">
                        <p>203923723</p>
                     </c>
                     <c ca="center">
                        <p>3'</p>
                     </c>
                     <c ca="center">
                        <p>0.41</p>
                     </c>
                     <c ca="center">
                        <p>97.09</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853063(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>203923730</p>
                     </c>
                     <c ca="center">
                        <p>3'</p>
                     </c>
                     <c ca="center">
                        <p>0.41</p>
                     </c>
                     <c ca="center">
                        <p>97.09</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853064(C > -)</p>
                     </c>
                     <c ca="center">
                        <p>203923933</p>
                     </c>
                     <c ca="center">
                        <p>3'</p>
                     </c>
                     <c ca="center">
                        <p>0.39</p>
                     </c>
                     <c ca="center">
                        <p>91.71</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>rs12066318(T > C)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>203924026</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>3'</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.33</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>tag SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DIL</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853065(- > ATG)</p>
                     </c>
                     <c ca="center">
                        <p>203924418</p>
                     </c>
                     <c ca="center">
                        <p>3'</p>
                     </c>
                     <c ca="center">
                        <p>0.45</p>
                     </c>
                     <c ca="center">
                        <p>84.94</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs11120769(G > T)</p>
                     </c>
                     <c ca="center">
                        <p>203925240</p>
                     </c>
                     <c ca="center">
                        <p>3'</p>
                     </c>
                     <c ca="center">
                        <p>0.45</p>
                     </c>
                     <c ca="center">
                        <p>83.28</p>
                     </c>
                     <c ca="center">
                        <p>DIL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs11117564(C > A)</p>
                     </c>
                     <c ca="center">
                        <p>203925366</p>
                     </c>
                     <c ca="center">
                        <p>3'</p>
                     </c>
                     <c ca="center">
                        <p>0.45</p>
                     </c>
                     <c ca="center">
                        <p>90.45</p>
                     </c>
                     <c ca="center">
                        <p>DIL &amp; HapMap</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>nsSNPs</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs28371588(>)</p>
                     </c>
                     <c ca="center">
                        <p>203884176</p>
                     </c>
                     <c ca="center">
                        <p>Exon 2</p>
                     </c>
                     <c ca="center">
                        <p>0.05</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>DAF-WESa/b(T > G)</p>
                     </c>
                     <c ca="center">
                        <p>203884266</p>
                     </c>
                     <c ca="center">
                        <p>Exon 2</p>
                     </c>
                     <c ca="center">
                        <p>0.0055</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs12135160(>)</p>
                     </c>
                     <c ca="center">
                        <p>203899090</p>
                     </c>
                     <c ca="center">
                        <p>Exon 8</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Tag SNP analysis of <it>DAF</it></p>
            </st>
            <p>To test for an association between T1D and the <it>DAF </it>region, we adopted a LD mapping approach, which exploits the non-random relationships between SNPs (known as LD) in a region of interest to reduce the amount of genotyping required. As the causal SNP is unknown, we assume that predicting the causal SNP is likely to be no more difficult than predicting any other SNP. The predictive performance of the tag SNPs was assessed using a <it>R</it><sup>2 </sup>measure, which measures the ability to predict each known SNP by multiple regression on the set of tag SNPs. The tag SNPs were analysed using a multilocus test, as described by Chapman <it>et al</it><abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, which tests for an association between the tag SNPs and T1D due to LD with one or more causal variants<abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>.</p>
            <p>We first combined our resequencing data with the HapMap data, providing a panel of 38 common polymorphisms genotyped in 32 individuals (Table <tblr tid="T1">1</tblr>), and generated a combined LD map of the region (Figure <figr fid="F1">1c</figr>). Subsequently, seven tag SNPs were selected<abbrgrp><abbr bid="B9">9</abbr></abbrgrp> from the 38 common polymorphisms, required to capture the variation within the <it>DAF </it>region with a minimum <it>R</it><sup>2 </sup>of 0.80<abbrgrp><abbr bid="B28">28</abbr></abbrgrp> (Table <tblr tid="T1">1</tblr>). The tag SNPs were genotyped in 3,523 cases and 3,817 controls, and in 725 Caucasian multiplex T1D families (Table <tblr tid="T2">2</tblr>). The case-control and family multilocus <it>P</it>-values were 0.12 (3,523 case and 3,817 control genotypes; F<sub>7,7321 </sub>= 1.63) and 0.69 (parent-child trio genotypes = 1,390; &#967;<sub>7</sub><sup>2 </sup>= 4.72), respectively, providing no evidence for the association between T1D and the <it>DAF </it>region. In the case-control collection, the multilocus test was stratified by broad geographical within the UK in order to minimize any confounding due to variation in allele frequencies across Great Britain<abbrgrp><abbr bid="B9">9</abbr><abbr bid="B30">30</abbr></abbrgrp>.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Genotyping data of tag SNPs. The number of individuals with each genotype in case-control data and the number of alleles in family data are indicated. T, Transmitted. UT, Untransmitted. MAF, minor allele frequency calculated from either control samples or parents.</p>
               </caption>
               <tblbdy cols="11">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5" ca="center">
                        <p>Case-Control</p>
                     </c>
                     <c cspan="5" ca="center">
                        <p>Family</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="11">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>SNP</p>
                     </c>
                     <c ca="center">
                        <p>Population</p>
                     </c>
                     <c ca="center">
                        <p>MAF</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>1/2</p>
                     </c>
                     <c ca="center">
                        <p>2/2</p>
                     </c>
                     <c ca="center">
                        <p>Population</p>
                     </c>
                     <c ca="center">
                        <p>MAF</p>
                     </c>
                     <c ca="center">
                        <p>Number of Trios</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>UT</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="11">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs2564978(C > T)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0.31</p>
                     </c>
                     <c ca="center">
                        <p>1648</p>
                     </c>
                     <c ca="center">
                        <p>1468</p>
                     </c>
                     <c ca="center">
                        <p>318</p>
                     </c>
                     <c ca="center">
                        <p>UK</p>
                     </c>
                     <c ca="center">
                        <p>0.32</p>
                     </c>
                     <c ca="center">
                        <p>738</p>
                     </c>
                     <c ca="center">
                        <p>483</p>
                     </c>
                     <c ca="center">
                        <p>458</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0.31</p>
                     </c>
                     <c ca="center">
                        <p>1791</p>
                     </c>
                     <c ca="center">
                        <p>1622</p>
                     </c>
                     <c ca="center">
                        <p>354</p>
                     </c>
                     <c ca="center">
                        <p>USA</p>
                     </c>
                     <c ca="center">
                        <p>0.27</p>
                     </c>
                     <c ca="center">
                        <p>526</p>
                     </c>
                     <c ca="center">
                        <p>272</p>
                     </c>
                     <c ca="center">
                        <p>289</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853053(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0.25</p>
                     </c>
                     <c ca="center">
                        <p>1895</p>
                     </c>
                     <c ca="center">
                        <p>1305</p>
                     </c>
                     <c ca="center">
                        <p>219</p>
                     </c>
                     <c ca="center">
                        <p>UK</p>
                     </c>
                     <c ca="center">
                        <p>0.24</p>
                     </c>
                     <c ca="center">
                        <p>736</p>
                     </c>
                     <c ca="center">
                        <p>345</p>
                     </c>
                     <c ca="center">
                        <p>350</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0.24</p>
                     </c>
                     <c ca="center">
                        <p>2147</p>
                     </c>
                     <c ca="center">
                        <p>1338</p>
                     </c>
                     <c ca="center">
                        <p>231</p>
                     </c>
                     <c ca="center">
                        <p>USA</p>
                     </c>
                     <c ca="center">
                        <p>0.29</p>
                     </c>
                     <c ca="center">
                        <p>536</p>
                     </c>
                     <c ca="center">
                        <p>317</p>
                     </c>
                     <c ca="center">
                        <p>304</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs4844590(C > T)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0.23</p>
                     </c>
                     <c ca="center">
                        <p>1987</p>
                     </c>
                     <c ca="center">
                        <p>1194</p>
                     </c>
                     <c ca="center">
                        <p>193</p>
                     </c>
                     <c ca="center">
                        <p>UK</p>
                     </c>
                     <c ca="center">
                        <p>0.21</p>
                     </c>
                     <c ca="center">
                        <p>711</p>
                     </c>
                     <c ca="center">
                        <p>287</p>
                     </c>
                     <c ca="center">
                        <p>309</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0.22</p>
                     </c>
                     <c ca="center">
                        <p>2288</p>
                     </c>
                     <c ca="center">
                        <p>1251</p>
                     </c>
                     <c ca="center">
                        <p>195</p>
                     </c>
                     <c ca="center">
                        <p>USA</p>
                     </c>
                     <c ca="center">
                        <p>0.26</p>
                     </c>
                     <c ca="center">
                        <p>517</p>
                     </c>
                     <c ca="center">
                        <p>272</p>
                     </c>
                     <c ca="center">
                        <p>270</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ss49853057(C > G)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0.07</p>
                     </c>
                     <c ca="center">
                        <p>2914</p>
                     </c>
                     <c ca="center">
                        <p>465</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>UK</p>
                     </c>
                     <c ca="center">
                        <p>0.08</p>
                     </c>
                     <c ca="center">
                        <p>709</p>
                     </c>
                     <c ca="center">
                        <p>113</p>
                     </c>
                     <c ca="center">
                        <p>101</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0.08</p>
                     </c>
                     <c ca="center">
                        <p>3071</p>
                     </c>
                     <c ca="center">
                        <p>580</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>USA</p>
                     </c>
                     <c ca="center">
                        <p>0.06</p>
                     </c>
                     <c ca="center">
                        <p>527</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs2184476(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0.31</p>
                     </c>
                     <c ca="center">
                        <p>1607</p>
                     </c>
                     <c ca="center">
                        <p>1447</p>
                     </c>
                     <c ca="center">
                        <p>314</p>
                     </c>
                     <c ca="center">
                        <p>UK</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>723</p>
                     </c>
                     <c ca="center">
                        <p>475</p>
                     </c>
                     <c ca="center">
                        <p>442</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0.31</p>
                     </c>
                     <c ca="center">
                        <p>1757</p>
                     </c>
                     <c ca="center">
                        <p>1578</p>
                     </c>
                     <c ca="center">
                        <p>345</p>
                     </c>
                     <c ca="center">
                        <p>USA</p>
                     </c>
                     <c ca="center">
                        <p>0.27</p>
                     </c>
                     <c ca="center">
                        <p>492</p>
                     </c>
                     <c ca="center">
                        <p>249</p>
                     </c>
                     <c ca="center">
                        <p>268</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs1507757(A > C)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0.31</p>
                     </c>
                     <c ca="center">
                        <p>1660</p>
                     </c>
                     <c ca="center">
                        <p>1469</p>
                     </c>
                     <c ca="center">
                        <p>319</p>
                     </c>
                     <c ca="center">
                        <p>UK</p>
                     </c>
                     <c ca="center">
                        <p>0.33</p>
                     </c>
                     <c ca="center">
                        <p>736</p>
                     </c>
                     <c ca="center">
                        <p>484</p>
                     </c>
                     <c ca="center">
                        <p>479</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0.31</p>
                     </c>
                     <c ca="center">
                        <p>1756</p>
                     </c>
                     <c ca="center">
                        <p>1586</p>
                     </c>
                     <c ca="center">
                        <p>349</p>
                     </c>
                     <c ca="center">
                        <p>USA</p>
                     </c>
                     <c ca="center">
                        <p>0.27</p>
                     </c>
                     <c ca="center">
                        <p>476</p>
                     </c>
                     <c ca="center">
                        <p>246</p>
                     </c>
                     <c ca="center">
                        <p>248</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs12066318(A > G)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0.44</p>
                     </c>
                     <c ca="center">
                        <p>658</p>
                     </c>
                     <c ca="center">
                        <p>1679</p>
                     </c>
                     <c ca="center">
                        <p>1104</p>
                     </c>
                     <c ca="center">
                        <p>UK</p>
                     </c>
                     <c ca="center">
                        <p>0.43</p>
                     </c>
                     <c ca="center">
                        <p>751</p>
                     </c>
                     <c ca="center">
                        <p>866</p>
                     </c>
                     <c ca="center">
                        <p>859</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0.45</p>
                     </c>
                     <c ca="center">
                        <p>738</p>
                     </c>
                     <c ca="center">
                        <p>1868</p>
                     </c>
                     <c ca="center">
                        <p>1135</p>
                     </c>
                     <c ca="center">
                        <p>USA</p>
                     </c>
                     <c ca="center">
                        <p>0.44</p>
                     </c>
                     <c ca="center">
                        <p>538</p>
                     </c>
                     <c ca="center">
                        <p>597</p>
                     </c>
                     <c ca="center">
                        <p>605</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Analysis of DAF non-synonymous SNPs</p>
            </st>
            <p>Recently, it has been proposed that complex diseases such as T1D may result from the effects of a large number of rare variants, with substantial allelic heterogeneity at causal loci<abbrgrp><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp>. In <it>DAF</it>, several rare non-synonymous SNPs (nsSNPs) were reported in the exons encoding the short consensus repeat (SCR) domains of the DAF protein, which have subsequently been shown to be related with antigen of the Cromer blood group system<abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>. On the basis of the rare variant hypothesis, we genotyped three rare nsSNPs in3,490 cases and 3,814 controls (Table <tblr tid="T3">3</tblr>), under the hypothesis that a rare functional variant in <it>DAF </it>might have a strong effect in T1D. The following three nsSNPs were assessed: DAF-WES<sup>a/b</sup>(G > T) located in exon 2 with a MAF of 0.0055&#8211;0.0060 in a Finnish population<abbrgrp><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>; rs28371588(C > A), also located in exon 2<abbrgrp><abbr bid="B34">34</abbr></abbrgrp>; and, rs12135160(G > A), identified by SsahaSNP detection tool (NIH and Sanger Institute, UK) in exon 8 and not previously genotyped. All result in amino-acid substitutions, but their phenotypic influences have not been characterized. In the present study, the MAF of rs12135160(G > A) was 0.00042 in 3,768 controls, and consequently, we have no statistical power to detect an association. Both rs28371588(C > A) and DAF-WES<sup>a/b</sup>(G > T) were monomorphic in the case-control collection.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Genotyping data of non-synonymous SNPs. The numbers of individuals with each genotype in case-control data are indicated. MAF, minor allele frequency calculated from control samples.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="center">
                        <p>SNP</p>
                     </c>
                     <c ca="center">
                        <p>Population</p>
                     </c>
                     <c ca="center">
                        <p>MAF</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>1/2</p>
                     </c>
                     <c ca="center">
                        <p>2/2</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs28371588(C > A)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>3420</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>3748</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>DAF-WESa/b(T > G)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>3438</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>3738</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>rs12135160(G > A)</p>
                     </c>
                     <c ca="center">
                        <p>Case</p>
                     </c>
                     <c ca="center">
                        <p>0.0004</p>
                     </c>
                     <c ca="center">
                        <p>3437</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Control</p>
                     </c>
                     <c ca="center">
                        <p>0.0004</p>
                     </c>
                     <c ca="center">
                        <p>3765</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>In this study, we did not find any evidence for an association between T1D and the <it>DAF </it>region in large case-control and family collections using a LD mapping approach. We combined the HapMap II genotyping data and resequencing data, for the selection of tag SNPs. Had we chosen the tag SNPs using only the HapMap II genotyping data, only two tag SNPs (rs2564978 and rs1507765) were required to capture the detected variation within the ~40 kb <it>DAF </it>region with a minumum <it>R</it><sup>2 </sup>of 0.8. However, when the predictive performance of the two tag SNPs were applied to the combined sequence dataset, they no longer captured the variation within the region to the required level since seven of the thirty-six common polymorphisms had an <it>R</it><sup>2 </sup>below 0.8. The inability of the tag SNPs selected from HapMap II data to tag the combined dataset (minimum <it>R</it><sup>2 </sup>= 0.35) suggests that for the analysis of localized regions containing candidate genes, as opposed to whole-genome association studies, HapMap II data alone may not provide sufficient information to facilitate a comprehensive LD-mapping approach. In the tag SNP approach, as the causal variant is unknown, we assume that the problem of predicting the causal polymorphism is likely to be no more difficult than that of predicting any other polymorphism<abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Consequently, the power of the tag SNP approach to detect a causal polymorphism is based upon the minimum <it>R</it><sup>2</sup><abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, assuming that the majority of common polymorphisms in a region are known. In this instance, incomplete knowledge of the common polymorphisms in a region inflated the minimum <it>R</it><sup>2</sup>, providing false confidence in the ability of the tag SNPs to capture the variation within a region, and in the power to detect a causal variant. Our results indicate that for some genes/regions HapMap II data may need to be supplemented by additional resequencing data to allow comprehensive association mapping of common variants.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We conclude that variation in <it>DAF </it>itself is unlikely to have a major effect in T1D in these populations. Analysis of an extended region, surrounding the <it>DAF </it>region analysed in this study, showed a cluster of several other genes involved in the complement system, including C4b binding protein (C4bp) and membrane cofactor protein (MCP), both known regulators of complement activation (RCA) genes<abbrgrp><abbr bid="B11">11</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr></abbrgrp>. C4bp and MCP restrict complement activation by inhibiting the formation of C3 convertases in the classical pathways like DAF, suggesting that they modulate each other in direct and indirect ways. To clarify the relation of autoimmune disease and complement system, including DAF, further genetic association studies and functional studies on RCA genes are needed. The set of tag SNPs and the LD map for the <it>DAF </it>region will be useful for such further studies.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Subjects</p>
            </st>
            <p>The resequencing panel consisted of 32 CEPH individuals; Utah residents with ancestry from Northern and Western Europe collected in 1980 by the Centre d'Etude du Polymorphisme Humain (CEPH).</p>
            <p>The 3,523 cases were recruited as part of the Juvenile Diabetes Research Foundation/Wellcome Trust Diabetes and Inflammation Laboratory's United Kingdom Genetic Resource Investigating Diabetes (U.K. GRID) study, which is a joint project between the University of Cambridge Department of Paediatrics and the Department of Medical Genetics at the Cambridge Institute for Medical Research. Most cases were &lt; 16 years of age at the time off collection, all resided in Great Britain, and all were of European descent (self-reported). The 3,817 control samples were obtained from the 1958 British Birth Cohort (1958 BBC), an ongoing follow-up of all person born in Great Britain during one week in 1958 (National Child Development Study)<abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. All cases and control were of white ethnicity.</p>
            <p>All families were Caucasian and of European descent, with two parents and at least one affected child. The family collection consisted of 457 multiplex families from the U.K. British Diabetic Association Warren 1 repository<abbrgrp><abbr bid="B40">40</abbr></abbrgrp> and 268 multiplex families from U.S.A. Human Biological Data Interchange<abbrgrp><abbr bid="B41">41</abbr></abbrgrp>.</p>
            <p>The Cambridge Local Research Ethics Committee gave full ethical approval, and informed consent was obtained for the collection and use of these DNA samples from all subjects.</p>
         </sec>
         <sec>
            <st>
               <p><it>DAF </it>resequencing</p>
            </st>
            <p>We first annotated the DAF gene locally<abbrgrp><abbr bid="B42">42</abbr><abbr bid="B43">43</abbr></abbrgrp> and displayed the annotation through gbrowse<abbrgrp><abbr bid="B44">44</abbr></abbrgrp> within T1DBase<abbrgrp><abbr bid="B45">45</abbr></abbrgrp>, using these annotations we resequenced all 11 exons, exon/intron boundaries and up to 3 kb of 3' and 5' flanking sequence of the DAF gene in 32 CEPH individuals, to increase the SNP density across the region. The sequencing reactions were carried out on nested PCR products using Applied Biosystems (ABI) BigDye terminator v3.1 chemistry and the sequences resolved on an ABI3700 DNA Analyser. Polymorphisms were identified using the Staden Package [46] and double-scored by a second operator.</p>
         </sec>
         <sec>
            <st>
               <p>Statistical analysis</p>
            </st>
            <p>The multilocus test has been described in detail elsewhere<abbrgrp><abbr bid="B9">9</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B47">47</abbr></abbrgrp>, briefly, for the case-control data, the multilocus test is essentially Hotellings <it>T</it><sup>2</sup><abbrgrp><abbr bid="B48">48</abbr><abbr bid="B49">49</abbr></abbrgrp>, in which we score each diallelic locus as 0, 1 or 2 and compare the mean score vectors between cases and control. In the case of the family data, the multilocus test takes the form of a multilocus TDT<abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, in which, for each parent, we calculate a vector whose elements describe transmissions of each of the tag SNPs. If the parent is homozygous at a locus, the corresponding element is scored as zero, otherwise it scored as either +1 or -1 depending on which allele was transmitted. The multilocus test tests the mean of this vector against zero; it is asymptotically distributed as a &#967;<sup>2 </sup>with degrees of freedom (df) equal to the number of tag SNPs<abbrgrp><abbr bid="B28">28</abbr><abbr bid="B47">47</abbr></abbrgrp>.</p>
            <p>The program for the selection of tag SNPs<abbrgrp><abbr bid="B28">28</abbr></abbrgrp> and association analysis used here are implemented in the <it>Stata </it>statistical system and may be downloaded from our website<abbrgrp><abbr bid="B50">50</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Genotyping</p>
            </st>
            <p>Genotyping was performed using Taqman MGB (Applied Biosytems Inc, Foster City, CA)<abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. All genotyping data were double-scored to minimize error. All genotyping data were in Hardy-Weinberg equilibrium (<it>P </it>> 0.05). Genotyping failure rates for all assays in both the family and case-control collection were &#8804; 6%.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>HT participated in the design of the study, gene annotation, sequencing, genotyping, data analysis and manuscript preparation. CEL participated in the design of the study, genotyping, data analysis and manuscript preparation. JDC participated in data analysis and manuscript preparation. DJS and RB participated in genotyping and sequencing. SN coordinated DNA resources. NMW coordinated data management. LS, BCH, ACL and OB participated in genome informatics. LSW and JAT participated in the conception, design and coordination of the study and participated in manuscript preparation. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We gratefully acknowledge the participation of all T1D patients and family members. We thank the Human Biological Data Interchange and Diabetes U.K. for USA and U.K. multiplex families, respectively. We acknowledge use of DNA from the 1958 British Birth Cohort collection, funded by the Medical Research Council grant G0000934 and Wellcome Trust grant 068545/Z/02. DNA samples were prepared by Jayne Hutchings, Gillian Coleman, Trupti Mistry, Kirsi Bourget, Sally Clayton, Matthew Hardy, Jennifer Keylock, Pamela Lauder, Meeta Maisuria, William Meadows, Meera Sebastian, Sarah Wood, The Avon Longitudinal Study of Parents and Children laboratory in Bristol, including Susan Ring, Wendy McArdle, Richard Jones, for preparing DNA samples.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Assessing the role of HLA-linked and unlinked determinants of disease</p>
            </title>
            <aug>
               <au>
                  <snm>Risch</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>1987</pubdate>
            <volume>40</volume>
            <fpage>1</fpage>
            <lpage>14</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3468804</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>A correlation between the relative predisposition of MHC class II alleles to type 1 diabetes and the structure of their proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Cucca</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lampis</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Congia</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Angius</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Nutland</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bain</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Barnett</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2001</pubdate>
            <volume>10</volume>
            <fpage>2025</fpage>
            <lpage>2037</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/10.19.2025</pubid>
                  <pubid idtype="pmpid" link="fulltext">11590120</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus</p>
            </title>
            <aug>
               <au>
                  <snm>Bell</snm>
                  <fnm>GI</fnm>
               </au>
               <au>
                  <snm>Horita</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Karam</snm>
                  <fnm>JH</fnm>
               </au>
            </aug>
            <source>Diabetes</source>
            <pubdate>1984</pubdate>
            <volume>33</volume>
            <fpage>176</fpage>
            <lpage>183</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6363172</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Remapping the insulin gene/IDDM2 locus in type 1 diabetes</p>
            </title>
            <aug>
               <au>
                  <snm>Barratt</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Payne</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lowe</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Hermann</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Healy</snm>
                  <fnm>BC</fnm>
               </au>
               <au>
                  <snm>Harold</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Concannon</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gharani</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>McCarthy</snm>
                  <fnm>MI</fnm>
               </au>
               <au>
                  <snm>Olavesen</snm>
                  <fnm>MG</fnm>
               </au>
               <au>
                  <snm>McCormack</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Guja</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ionescu-Tirgoviste</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Undlien</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Ronningen</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Gillespie</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Tuomilehto-Wolf</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Tuomilehto</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bennett </snm>
                  <fnm>ST</fnm>
               </au>
               <au>
                  <snm>Clayton</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Cordell</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Diabetes</source>
            <pubdate>2004</pubdate>
            <volume>53</volume>
            <fpage>1884</fpage>
            <lpage>1889</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15220214</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The CTLA-4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes. Belgian Diabetes Registry</p>
            </title>
            <aug>
               <au>
                  <snm>Nistico</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Buzzetti</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pritchard</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Van der Auwera</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Giovannini</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bosi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Larrad</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Rios</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Chow</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Cockram</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Jacobs</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Mijovic</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bain</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Barnett</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Vandewalle</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Schuit</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Gorus</snm>
                  <fnm>FK</fnm>
               </au>
               <au>
                  <snm>Tosi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pozzilli</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>1996</pubdate>
            <volume>5</volume>
            <fpage>1075</fpage>
            <lpage>1080</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/5.7.1075</pubid>
                  <pubid idtype="pmpid" link="fulltext">8817351</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease</p>
            </title>
            <aug>
               <au>
                  <snm>Ueda</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Howson</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Esposito</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Heward</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Snook</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Chamberlain</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Rainbow</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Hunter</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>AN</fnm>
               </au>
               <au>
                  <snm>Di Genova</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Herr</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Dahlman</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Payne</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Smyth</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lowe</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Twells</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Howlett</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Healy</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Nutland</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rance</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Everett</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Smink</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Lam</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Cordell</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Bordin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hulme</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Motzo</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Cucca</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Hess</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Metzker</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Rogers</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gregory</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Allahabadia</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nithiyananthan</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Tuomilehto-Wolf</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Tuomilehto</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bingley</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gillespie</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Undlien</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Ronningen</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Guja</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ionescu-Tirgoviste</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Savage</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Maxwell</snm>
                  <fnm>AP</fnm>
               </au>
               <au>
                  <snm>Carson</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Patterson</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Franklyn</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Clayton</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Peterson</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Wicker</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Gough</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2003</pubdate>
            <volume>423</volume>
            <fpage>506</fpage>
            <lpage>511</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature01621</pubid>
                  <pubid idtype="pmpid" link="fulltext">12724780</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Replication of an association betweenthe lymphoid tyrosine phosphatase locus (LYP/PTPN22) with type 1 diabetes, and evidence for its role as a general autoimmunity locus</p>
            </title>
            <aug>
               <au>
                  <snm>Smyth</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Collins</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Heward</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Franklyn</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Howson</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Vella</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nutland</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rance</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Maier</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Barratt</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Guja</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ionescu-Tirgoviste</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Savage</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Dunger</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Widmer</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Strachan</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Ring</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Clayton</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Twells</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Gough</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Diabetes</source>
            <pubdate>2004</pubdate>
            <volume>53</volume>
            <fpage>3020</fpage>
            <lpage>3023</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15504986</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>A functional variant of lymphoid tyrosine phosphatase is associated with type I diabetes</p>
            </title>
            <aug>
               <au>
                  <snm>Bottini</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Musumeci</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Alonso</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rahmouni</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nika</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Rostamkhani</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>MacMurray</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Meloni</snm>
                  <fnm>GF</fnm>
               </au>
               <au>
                  <snm>Lucarelli</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Pellecchia</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Eisenbarth</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Comings</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Mustelin</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2004</pubdate>
            <volume>36</volume>
            <fpage>337</fpage>
            <lpage>338</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng1323</pubid>
                  <pubid idtype="pmpid" link="fulltext">15004560</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Localization of a type 1 diabetes locus in the IL2RA/CD25 region by use of tag single-nucleotide polymorphisms</p>
            </title>
            <aug>
               <au>
                  <snm>Vella</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Lowe</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nutland</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Widmer</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ring</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>McArdle</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Pembrey</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Strachan</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Dunger</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Twells</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Clayton</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2005</pubdate>
            <volume>76</volume>
            <fpage>773</fpage>
            <lpage>779</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1199367</pubid>
                  <pubid idtype="pmpid" link="fulltext">15776395</pubid>
                  <pubid idtype="doi">10.1086/429843</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Membrane complement regulatory proteins: insight from animal studies and relevance to human diseases</p>
            </title>
            <aug>
               <au>
                  <snm>Miwa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Int Immunopharmacol</source>
            <pubdate>2001</pubdate>
            <volume>1</volume>
            <fpage>445</fpage>
            <lpage>459</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1567-5769(00)00043-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">11367529</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Regulation of the complement membrane attack pathway</p>
            </title>
            <aug>
               <au>
                  <snm>Morgan</snm>
                  <fnm>BP</fnm>
               </au>
            </aug>
            <source>Crit Rev Immunol</source>
            <pubdate>1999</pubdate>
            <volume>19</volume>
            <fpage>173</fpage>
            <lpage>198</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10422598</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Complement: a unique innate immune sensor for danger signals</p>
            </title>
            <aug>
               <au>
                  <snm>Gasque</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Mol Immunol</source>
            <pubdate>2004</pubdate>
            <volume>41</volume>
            <fpage>1089</fpage>
            <lpage>1098</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.molimm.2004.06.011</pubid>
                  <pubid idtype="pmpid" link="fulltext">15476920</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Review: Cromer and DAF: role in health and disease</p>
            </title>
            <aug>
               <au>
                  <snm>Lublin</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Immunohematol</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <fpage>39</fpage>
            <lpage>47</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15954803</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Molecular basis of Cromer blood group antigens</p>
            </title>
            <aug>
               <au>
                  <snm>Lublin</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Kompelli</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Storry</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Reid</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>2000</pubdate>
            <volume>40</volume>
            <fpage>208</fpage>
            <lpage>213</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.2000.40020208.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10686005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>The Cromer blood group system: a review</p>
            </title>
            <aug>
               <au>
                  <snm>Storry</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Reid</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>Immunohematol</source>
            <pubdate>2002</pubdate>
            <volume>18</volume>
            <fpage>95</fpage>
            <lpage>103</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15373545</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Novel molecular basis of an Inab phenotype</p>
            </title>
            <aug>
               <au>
                  <snm>Hue-Roye</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Powell</snm>
                  <fnm>VI</fnm>
               </au>
               <au>
                  <snm>Patel</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Lane</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Maguire</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Chung</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Reid</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>Immunohematol</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <fpage>53</fpage>
            <lpage>55</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15954804</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Decay-accelerating factor deficiency increases susceptibility to dextran sulfate sodium-induced colitis: role for complement in inflammatorybowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Lin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Spencer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hatala</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Levine</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Medof</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2004</pubdate>
            <volume>172</volume>
            <fpage>3836</fpage>
            <lpage>3841</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15004190</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Antigen-presenting cell exosomes are protected from complement-mediated lysis by expression of CD55 and CD59</p>
            </title>
            <aug>
               <au>
                  <snm>Clayton</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Harris</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Court</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Mason</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Morgan</snm>
                  <fnm>BP</fnm>
               </au>
            </aug>
            <source>Eur J Immunol</source>
            <pubdate>2003</pubdate>
            <volume>33</volume>
            <fpage>522</fpage>
            <lpage>531</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/immu.200310028</pubid>
                  <pubid idtype="pmpid" link="fulltext">12645951</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Decay-accelerating factor modulates induction of T cell immunity</p>
            </title>
            <aug>
               <au>
                  <snm>Heeger</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Lalli</snm>
                  <fnm>PN</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Valujskikh</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Muqim</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Medof</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>J Exp Med</source>
            <pubdate>2005</pubdate>
            <volume>201</volume>
            <fpage>1523</fpage>
            <lpage>1530</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1084/jem.20041967</pubid>
                  <pubid idtype="pmpid" link="fulltext">15883171</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>The complement inhibitory protein DAF (CD55) suppresses T cell immunity in vivo</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Miwa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hilliard</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Lambris</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Wells</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>J Exp Med</source>
            <pubdate>2005</pubdate>
            <volume>201</volume>
            <fpage>567</fpage>
            <lpage>577</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1084/jem.20040863</pubid>
                  <pubid idtype="pmpid" link="fulltext">15710649</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Deletion of decay-accelerating factor (CD55) exacerbates autoimmune disease development in MRL/lpr mice</p>
            </title>
            <aug>
               <au>
                  <snm>Miwa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Maldonado</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Luo</snm>
                  <fnm>HY</fnm>
               </au>
               <au>
                  <snm>Cai</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Werth</snm>
                  <fnm>VP</fnm>
               </au>
               <au>
                  <snm>Madaio</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Eisenberg</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>2002</pubdate>
            <volume>161</volume>
            <fpage>1077</fpage>
            <lpage>1086</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12213736</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>The complement system as a therapeutic target in autoimmunity</p>
            </title>
            <aug>
               <au>
                  <snm>Holers</snm>
                  <fnm>VM</fnm>
               </au>
            </aug>
            <source>Clin Immunol</source>
            <pubdate>2003</pubdate>
            <volume>107</volume>
            <fpage>140</fpage>
            <lpage>151</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1521-6616(03)00034-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">12804527</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Type 1 diabetes: evidence for susceptibility Loci from four genome-wide linkage scans in 1,435 multiplex families</p>
            </title>
            <aug>
               <au>
                  <snm>Concannon</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Erlich</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Julier</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Morahan</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Nerup</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Pociot</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Rich</snm>
                  <fnm>SS</fnm>
               </au>
            </aug>
            <source>Diabetes</source>
            <pubdate>2005</pubdate>
            <volume>54</volume>
            <fpage>2995</fpage>
            <lpage>3001</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16186404</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Seven regions of the genome show evidence of linkage to type 1 diabetes in a consensus analysis of 767 multiplex families</p>
            </title>
            <aug>
               <au>
                  <snm>Cox</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Wapelhorst</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Morrison</snm>
                  <fnm>VA</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Pinchuk</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Spielman</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Concannon</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2001</pubdate>
            <volume>69</volume>
            <fpage>820</fpage>
            <lpage>830</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1226067</pubid>
                  <pubid idtype="pmpid" link="fulltext">11507694</pubid>
                  <pubid idtype="doi">10.1086/323501</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>International HapMap Project</p>
            </title>
            <url>http://www.hapmap.org</url>
         </bibl>
         <bibl id="B26">
            <title>
               <p>A haplotype map of the human genome</p>
            </title>
            <aug>
               <au>
                  <snm>Altshuler</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Brooks</snm>
                  <fnm>LD</fnm>
               </au>
               <au>
                  <snm>Chakravarti</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Collins</snm>
                  <fnm>FS</fnm>
               </au>
               <au>
                  <snm>Daly</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Donnelly</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2005</pubdate>
            <volume>437</volume>
            <fpage>1299</fpage>
            <lpage>1320</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature04226</pubid>
                  <pubid idtype="pmpid">16255080</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>The usefulness of different density SNP maps for disease association studies of common variants</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>WY</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2003</pubdate>
            <volume>12</volume>
            <fpage>3145</fpage>
            <lpage>3149</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddg337</pubid>
                  <pubid idtype="pmpid" link="fulltext">14532327</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Detecting disease associations due to linkage disequilibrium using haplotype tags: a class of tests and the determinants of statistical power</p>
            </title>
            <aug>
               <au>
                  <snm>Chapman</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Clayton</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Hum Hered</source>
            <pubdate>2003</pubdate>
            <volume>56</volume>
            <fpage>18</fpage>
            <lpage>31</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1159/000073729</pubid>
                  <pubid idtype="pmpid" link="fulltext">14614235</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Use of unphased multilocus genotype data in indirect association studies</p>
            </title>
            <aug>
               <au>
                  <snm>Clayton</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Chapman</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Genet Epidemiol</source>
            <pubdate>2004</pubdate>
            <volume>27</volume>
            <fpage>415</fpage>
            <lpage>428</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/gepi.20032</pubid>
                  <pubid idtype="pmpid" link="fulltext">15481099</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Population structure, differential bias and genomic control in a large-scale, case-control association study</p>
            </title>
            <aug>
               <au>
                  <snm>Clayton</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Smyth</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Pask</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Maier</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Smink</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Lam</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Ovington</snm>
                  <fnm>NR</fnm>
               </au>
               <au>
                  <snm>Stevens</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Nutland</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Howson</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Faham</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Moorhead</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>HB</fnm>
               </au>
               <au>
                  <snm>Falkowski</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hardenbol</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Willis</snm>
                  <fnm>TD</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2005</pubdate>
            <volume>37</volume>
            <fpage>1243</fpage>
            <lpage>1246</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng1653</pubid>
                  <pubid idtype="pmpid" link="fulltext">16228001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Emerging trends in the search for genetic variants predisposing to human obesity</p>
            </title>
            <aug>
               <au>
                  <snm>Swarbrick</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Vaisse</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Curr Opin Clin Nutr Metab Care</source>
            <pubdate>2003</pubdate>
            <volume>6</volume>
            <fpage>369</fpage>
            <lpage>375</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00075197-200307000-00003</pubid>
                  <pubid idtype="pmpid" link="fulltext">12806208</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Rare variant hypothesis for multifactorial inheritance: susceptibility to colorectal adenomas as a model</p>
            </title>
            <aug>
               <au>
                  <snm>Fearnhead</snm>
                  <fnm>NS</fnm>
               </au>
               <au>
                  <snm>Winney</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bodmer</snm>
                  <fnm>WF</fnm>
               </au>
            </aug>
            <source>Cell Cycle</source>
            <pubdate>2005</pubdate>
            <volume>4</volume>
            <fpage>521</fpage>
            <lpage>525</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15753653</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>GUTI: a new antigen in the Cromer blood group system</p>
            </title>
            <aug>
               <au>
                  <snm>Storry</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Sausais</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Hue-Roye</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Mudiwa</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ferrer</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Blajchman</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Lublin</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Ma</snm>
                  <fnm>BW</fnm>
               </au>
               <au>
                  <snm>Miquel</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Nervi</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Pereira</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Reid</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>2003</pubdate>
            <volume>43</volume>
            <fpage>340</fpage>
            <lpage>344</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.2003.00319.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12675719</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Molecular mapping of the Cromer blood group Cra and Tca epitopes of decay accelerating factor: toward the use of recombinant antigens in immunohematology</p>
            </title>
            <aug>
               <au>
                  <snm>Telen</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Udani</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Kaufman</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Lublin</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1994</pubdate>
            <volume>84</volume>
            <fpage>3205</fpage>
            <lpage>3211</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">7524769</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>A 'new' Cromer-related high frequency antigen probably antithetical to WES</p>
            </title>
            <aug>
               <au>
                  <snm>Daniels</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Darr</snm>
                  <fnm>FW</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sistonen</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Vox Sang</source>
            <pubdate>1987</pubdate>
            <volume>53</volume>
            <fpage>235</fpage>
            <lpage>238</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3439100</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>WES, a 'new' infrequent blood group antigen in Finns</p>
            </title>
            <aug>
               <au>
                  <snm>Sistonen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Nevanlinna</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>Virtaranta-Knowles</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tuominen</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Pirkola</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Tippett</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Vox Sang</source>
            <pubdate>1987</pubdate>
            <volume>52</volume>
            <fpage>111</fpage>
            <lpage>114</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3300022</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Human complement regulators:a major target for pathogenic microorganisms</p>
            </title>
            <aug>
               <au>
                  <snm>Lindahl</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Sjobring</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Johnsson</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Curr Opin Immunol</source>
            <pubdate>2000</pubdate>
            <volume>12</volume>
            <fpage>44</fpage>
            <lpage>51</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0952-7915(99)00049-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">10679403</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Membrane cofactor protein (MCP or CD46): newest member of the regulators of complement activation gene cluster</p>
            </title>
            <aug>
               <au>
                  <snm>Liszewski</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Post</snm>
                  <fnm>TW</fnm>
               </au>
               <au>
                  <snm>Atkinson</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Annu Rev Immunol</source>
            <pubdate>1991</pubdate>
            <volume>9</volume>
            <fpage>431</fpage>
            <lpage>455</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.iy.09.040191.002243</pubid>
                  <pubid idtype="pmpid" link="fulltext">1910685</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Cohort profile: 1958 British birth cohort (National Child Development Study)</p>
            </title>
            <aug>
               <au>
                  <snm>Power</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Elliott</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Int J Epidemiol</source>
            <pubdate>2006</pubdate>
            <volume>35</volume>
            <fpage>34</fpage>
            <lpage>41</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/ije/dyi183</pubid>
                  <pubid idtype="pmpid" link="fulltext">16155052</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>The British Diabetic Association&#8211;Warren repository</p>
            </title>
            <aug>
               <au>
                  <snm>Bain</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Barnett</snm>
                  <fnm>AH</fnm>
               </au>
            </aug>
            <source>Autoimmunity</source>
            <pubdate>1990</pubdate>
            <volume>7</volume>
            <fpage>83</fpage>
            <lpage>85</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2151758</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Family cell lines available for research</p>
            </title>
            <aug>
               <au>
                  <snm>Lernmark</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ducat</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Eisenbarth</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ott</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Permutt</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Rubenstein</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Spielman</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>1990</pubdate>
            <volume>47</volume>
            <fpage>1028</fpage>
            <lpage>1030</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2239968</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Development of an integrated genome informatics, data management and workflow infrastructure: a toolbox for the study of complex disease genetics</p>
            </title>
            <aug>
               <au>
                  <snm>Burren</snm>
                  <fnm>OS</fnm>
               </au>
               <au>
                  <snm>Healy</snm>
                  <fnm>BC</fnm>
               </au>
               <au>
                  <snm>Lam</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Schuilenburg</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Dolman</snm>
                  <fnm>GE</fnm>
               </au>
               <au>
                  <snm>Everett</snm>
                  <fnm>VH</fnm>
               </au>
               <au>
                  <snm>Laneri</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Nutland</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rance</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Payne</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Smyth</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lowe</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Barratt</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Twells</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Rainbow</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Wicker</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Smink</snm>
                  <fnm>LJ</fnm>
               </au>
            </aug>
            <source>Hum Genomics</source>
            <pubdate>2004</pubdate>
            <volume>1</volume>
            <fpage>98</fpage>
            <lpage>109</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15601538</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>T1DBase, a community web-based resource for type 1 diabetes research</p>
            </title>
            <aug>
               <au>
                  <snm>Smink</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Helton</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Healy</snm>
                  <fnm>BC</fnm>
               </au>
               <au>
                  <snm>Cavnor</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Lam</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Flamez</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Burren</snm>
                  <fnm>OS</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Dolman</snm>
                  <fnm>GE</fnm>
               </au>
               <au>
                  <snm>Burdick</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Everett</snm>
                  <fnm>VH</fnm>
               </au>
               <au>
                  <snm>Glusman</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Laneri</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Rowen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Schuilenburg</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Mychaleckyj</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wicker</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Eizirik</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Goodman</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2005</pubdate>
            <issue>33 Database</issue>
            <fpage>D544</fpage>
            <lpage>549</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">540049</pubid>
                  <pubid idtype="pmpid" link="fulltext">15608258</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Gbrowse</p>
            </title>
            <url>http://www.gmod.org/</url>
         </bibl>
         <bibl id="B45">
            <title>
               <p>T1DBase</p>
            </title>
            <url>http://t1dbase.org/cgi-bin/dispatcher.cgi/Welcome/display</url>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Automated detection of point mutations using fluorescent sequence trace subtraction</p>
            </title>
            <aug>
               <au>
                  <snm>Bonfield</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Rada</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Staden</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1998</pubdate>
            <volume>26</volume>
            <fpage>3404</fpage>
            <lpage>3409</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">147706</pubid>
                  <pubid idtype="pmpid" link="fulltext">9649626</pubid>
                  <pubid idtype="doi">10.1093/nar/26.14.3404</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Cost-effective analysis of candidate genes using htSNPs: a staged approach</p>
            </title>
            <aug>
               <au>
                  <snm>Lowe</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Chapman</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Barratt</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Twells</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Savage</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Guja</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ionescu-Tirgoviste</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tuomilehto-Wolf</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Tuomilehto</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Todd</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Clayton</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Genes Immun</source>
            <pubdate>2004</pubdate>
            <volume>5</volume>
            <fpage>301</fpage>
            <lpage>305</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.gene.6364064</pubid>
                  <pubid idtype="pmpid" link="fulltext">15029236</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Genetic associations in large versus small studies: an empirical assessment</p>
            </title>
            <aug>
               <au>
                  <snm>Ioannidis</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Trikalinos</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Ntzani</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Contopoulos-Ioannidis</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>2003</pubdate>
            <volume>361</volume>
            <fpage>567</fpage>
            <lpage>571</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0140-6736(03)12516-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">12598142</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Cost-effectivedesigns for linkage disequilibrium mapping of complex traits</p>
            </title>
            <aug>
               <au>
                  <snm>Service</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Sandkuijl</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Freimer</snm>
                  <fnm>NB</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2003</pubdate>
            <volume>72</volume>
            <fpage>1213</fpage>
            <lpage>1220</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1180273</pubid>
                  <pubid idtype="pmpid" link="fulltext">12696019</pubid>
                  <pubid idtype="doi">10.1086/375165</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>JDRF/WT Diabetes and Inflammation Laboratory</p>
            </title>
            <url>http://www-gene.cimr.cam.ac.uk/clayton/software/stata</url>
         </bibl>
         <bibl id="B51">
            <title>
               <p>High -throught genotyping with single nucleotide polymorphisms</p>
            </title>
            <aug>
               <au>
                  <snm>Ranade</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Ting</snm>
                  <fnm>CT</fnm>
               </au>
               <au>
                  <snm>Pei</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hsiao</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Oliver</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pesich</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hebert</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>YD</fnm>
               </au>
               <au>
                  <snm>Dzau</snm>
                  <fnm>VJ</fnm>
               </au>
               <au>
                  <snm>Curb</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Olshen</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Risch</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Cox</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Botstein</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2001</pubdate>
            <volume>11</volume>
            <fpage>1262</fpage>
            <lpage>1268</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">311112</pubid>
                  <pubid idtype="pmpid" link="fulltext">11435409</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
